pLenti PA-mCit-NL
(Plasmid
#113452)
-
PurposeLentiviral ProteinA-mCitrine-NanoLuc hybrid-fusion control expression vector (positive control)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113452 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneFUGW
-
Backbone manufacturerFUGW was a gift from David Baltimore (Addgene plasmid # 14883)
- Total vector size (bp) 10311
-
Vector typeMammalian Expression, Lentiviral, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameProteinA-mCitrine-NanoLuc
-
Insert Size (bp)1650
- Promoter hUBbC
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer tgaagctccggttttgaact
- 3′ sequencing primer ggcattaaagcagcgtatcc (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byViral Core Facility (VCF) of the Charité – Universitätsmedizin Berlin
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti PA-mCit-NL was a gift from Erich Wanker (Addgene plasmid # 113452 ; http://n2t.net/addgene:113452 ; RRID:Addgene_113452) -
For your References section:
LuTHy: a double-readout bioluminescence-based two-hybrid technology for quantitative mapping of protein-protein interactions in mammalian cells. Trepte P, Kruse S, Kostova S, Hoffmann S, Buntru A, Tempelmeier A, Secker C, Diez L, Schulz A, Klockmeier K, Zenkner M, Golusik S, Rau K, Schnoegl S, Garner CC, Wanker EE. Mol Syst Biol. 2018 Jul 11;14(7):e8071. doi: 10.15252/msb.20178071. 10.15252/msb.20178071 PubMed 29997244