Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pDAI-SceI-SacB
(Plasmid #113635)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 113635 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Tetracycline, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    sacB
  • Mutation
    Please see Depositor Comments
  • Promoter sacB promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer GCCTTCT TGACGAGTTCTTCTG
  • 3′ sequencing primer TCGAGCAAGCTGCAGTTATTTGTTAAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene NGS found K43E and T318P within the SacB translation compared to the best match NCBI reference sequence (ACF93714.1). The depositing laboratory confirms that these mutations should not adversely affect plasmid function

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDAI-SceI-SacB was a gift from Miguel Valvano (Addgene plasmid # 113635 ; http://n2t.net/addgene:113635 ; RRID:Addgene_113635)
  • For your References section:

    A markerless deletion method for genetic manipulation of Burkholderia cenocepacia and other multidrug-resistant gram-negative bacteria. Aubert DF, Hamad MA, Valvano MA. Methods Mol Biol. 2014;1197:311-27. doi: 10.1007/978-1-4939-1261-2_18. 10.1007/978-1-4939-1261-2_18 PubMed 25172289