Skip to main content
Addgene

pURD214
(Plasmid #113871)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 113871 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pROS10 (#107924)
  • Backbone manufacturer
    Mans et al FEMS Yeast Res. 2015 Mar;15(2). pii: fov004
  • Backbone size w/o insert (bp) 5577
  • Total vector size (bp) 5577
  • Modifications to backbone
    Replacement of the double CAN1 sgRNA with sgRNA5 HXT13-15-16 sgRNA2-HXT2
  • Vector type
    Yeast Expression, CRISPR
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA5 HXT13-15-16 sgRNA2-HXT2
  • gRNA/shRNA sequence
    TGGTCATATTTGCAAGTATC / ACTAATAGCGAAGAAGAAAA
  • Species
    S. cerevisiae (budding yeast)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The backbone of the pMEL and pROS series was derived from p426-SNR52p-gRNA.CAN1.Y-SUP4t (Addgene # 43803).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Backbone pROS10 is described in ""CRISPR/Cas9: a molecular Swiss army knife for simultaneous introduction of multiple genetic modifications in Saccharomyces cerevisiae. Mans R, van Rossum HM, Wijsman M, Backx A, Kuijpers NG, van den Broek M, Daran-Lapujade P, Pronk JT, van Maris AJ, Daran JM. FEMS Yeast Res. 2015 Mar;15(2). pii: fov004. doi: 10.1093/femsyr/fov004. Epub 2015 Mar 4. 10.1093/femsyr/fov004 PubMed 25743786

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pURD214 was a gift from Jean-Marc Daran & Jack Pronk (Addgene plasmid # 113871 ; http://n2t.net/addgene:113871 ; RRID:Addgene_113871)
  • For your References section:

    A toolkit for rapid CRISPR-SpCas9 assisted construction of hexose-transport-deficient Saccharomyces cerevisiae strains. Wijsman M, Swiat MA, Marques WL, Hettinga JK, van den Broek M, Torre Cortes P, Mans R, Pronk JT, Daran JM, Daran-Lapujade P. FEMS Yeast Res. 2019 Jan 1;19(1). pii: 5114578. doi: 10.1093/femsyr/foy107. 10.1093/femsyr/foy107 PubMed 30285096