Skip to main content

p3s-Sniper-Cas9
(Plasmid #113912)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 113912 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCDNA3.1
  • Backbone manufacturer
    invitrogen
  • Backbone size w/o insert (bp) 3200
  • Total vector size (bp) 7383
  • Modifications to backbone
    PvuII digestion and re-ligation to delete non-essential element in p3-Sniper-Cas9.
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Sniper-Cas9
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p3s-Sniper-Cas9 was a gift from Jungjoon Lee (Addgene plasmid # 113912 ; http://n2t.net/addgene:113912 ; RRID:Addgene_113912)
  • For your References section:

    Directed evolution of CRISPR-Cas9 to increase its specificity. Lee JK, Jeong E, Lee J, Jung M, Shin E, Kim YH, Lee K, Jung I, Kim D, Kim S, Kim JS. Nat Commun. 2018 Aug 6;9(1):3048. doi: 10.1038/s41467-018-05477-x. 10.1038/s41467-018-05477-x PubMed 30082838