-
PurposeExpresses Sniper-Cas9 with CMV promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113912 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCDNA3.1
-
Backbone manufacturerinvitrogen
- Backbone size w/o insert (bp) 3200
- Total vector size (bp) 7383
-
Modifications to backbonePvuII digestion and re-ligation to delete non-essential element in p3-Sniper-Cas9.
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSniper-Cas9
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p3s-Sniper-Cas9 was a gift from Jungjoon Lee (Addgene plasmid # 113912 ; http://n2t.net/addgene:113912 ; RRID:Addgene_113912) -
For your References section:
Directed evolution of CRISPR-Cas9 to increase its specificity. Lee JK, Jeong E, Lee J, Jung M, Shin E, Kim YH, Lee K, Jung I, Kim D, Kim S, Kim JS. Nat Commun. 2018 Aug 6;9(1):3048. doi: 10.1038/s41467-018-05477-x. 10.1038/s41467-018-05477-x PubMed 30082838