Skip to main content

pAAV-hSyn-iLMO (slGLuc-Mac-EYFP)
(Plasmid #114100)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 114100 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 4563
  • Total vector size (bp) 7010
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Gaussia luciferase, superluminescent; Leptosphaeria maculans opsin; EYFP
  • Alt name
    slGLuc-Mac-EYFP
  • Alt name
    iLMO
  • Species
    Synthetic; Leptosphaeria maculans
  • Promoter hSyn

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ACTGAAGGCGCGCTGACGTCACT
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-iLMO (slGLuc-Mac-EYFP) was a gift from Ute Hochgeschwender (Addgene plasmid # 114100 ; http://n2t.net/addgene:114100 ; RRID:Addgene_114100)
  • For your References section:

    Luminopsins integrate opto- and chemogenetics by using physical and biological light sources for opsin activation. Berglund K, Clissold K, Li HE, Wen L, Park SY, Gleixner J, Klein ME, Lu D, Barter JW, Rossi MA, Augustine GJ, Yin HH, Hochgeschwender U. Proc Natl Acad Sci U S A. 2016 Jan 19;113(3):E358-67. doi: 10.1073/pnas.1510899113. Epub 2016 Jan 5. 10.1073/pnas.1510899113 PubMed 26733686