Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-hSyn-iLMO (slGLuc-Mac-EYFP)
(Plasmid #114100)


Item Catalog # Description Quantity Price (USD)
Plasmid 114100 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 4563
  • Total vector size (bp) 7010
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    Gaussia luciferase, superluminescent
  • Alt name
  • Promoter hSyn

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ACTGAAGGCGCGCTGACGTCACT
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Leptosphaeria maculans
  • Alt name

Gene/Insert 3

  • Gene/Insert name
    Enhanced Yellow Fluorescent Protein
  • Alt name

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-iLMO (slGLuc-Mac-EYFP) was a gift from Ute Hochgeschwender (Addgene plasmid # 114100 ; ; RRID:Addgene_114100)
  • For your References section:

    Luminopsins integrate opto- and chemogenetics by using physical and biological light sources for opsin activation. Berglund K, Clissold K, Li HE, Wen L, Park SY, Gleixner J, Klein ME, Lu D, Barter JW, Rossi MA, Augustine GJ, Yin HH, Hochgeschwender U. Proc Natl Acad Sci U S A. 2016 Jan 19;113(3):E358-67. doi: 10.1073/pnas.1510899113. Epub 2016 Jan 5. 10.1073/pnas.1510899113 PubMed 26733686