-
PurposeLentivirus compatible dCas9-VPR construct driven by the CAG promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 114197 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonelentiCRISPR v2
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedCas9-VPR
-
SpeciesSynthetic
-
Insert Size (bp)5865
- Promoter CAG
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTTTATTACAGGGACAGCAGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene #63798 into lentivirus backbone and addition of N-term FLAG tag.
Please note: Addgene NGS was unable to fully resolve the GC rich sequence within the Chicken beta-actin promoter. Please refer to the depositor sequence for that region. Please visit https://www.biorxiv.org/content/early/2018/07/17/371500 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lenti CAG-FLAG-dCas9-VPR was a gift from Jeremy Day (Addgene plasmid # 114197 ; http://n2t.net/addgene:114197 ; RRID:Addgene_114197) -
For your References section:
A Neuron-Optimized CRISPR/dCas9 Activation System for Robust and Specific Gene Regulation. Savell KE, Bach SV, Zipperly ME, Revanna JS, Goska NA, Tuscher JJ, Duke CG, Sultan FA, Burke JN, Williams D, Ianov L, Day JJ. eNeuro. 2019 Mar 7;6(1). pii: eN-MNT-0495-18. doi: 10.1523/ENEURO.0495-18.2019. eCollection 2019 Jan-Feb. 10.1523/ENEURO.0495-18.2019 PubMed 30863790