Calb1-T2A-dgCre targeting vector
(Plasmid
#114438)
-
PurposeTarget dgCre into the endogenous mouse Calb1 locus at the stop codon
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 114438 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBS SK2+
- Backbone size w/o insert (bp) 5495
- Total vector size (bp) 17700
-
Vector typeMouse Targeting
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namedgCre
-
Alt nameDHFR-EGFP-Cre
-
Insert Size (bp)2331
- Promoter none; utilizes endogenous Calb1 promoter for expression
-
Tag
/ Fusion Protein
- DHFR domain and EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (unknown if destroyed)
- 3′ cloning site XmaI (unknown if destroyed)
- 5′ sequencing primer GACATGCGGAGACGTGGAAGAGA
- 3′ sequencing primer GACATGCGGAGACGTGGAAGAGA
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Calb1-T2A-dgCre targeting vector was a gift from Hongkui Zeng (Addgene plasmid # 114438 ; http://n2t.net/addgene:114438 ; RRID:Addgene_114438) -
For your References section:
A Suite of Transgenic Driver and Reporter Mouse Lines with Enhanced Brain-Cell-Type Targeting and Functionality. Daigle TL, Madisen L, Hage TA, Valley MT, Knoblich U, Larsen RS, Takeno MM, Huang L, Gu H, Larsen R, Mills M, Bosma-Moody A, Siverts LA, Walker M, Graybuck LT, Yao Z, Fong O, Nguyen TN, Garren E, Lenz GH, Chavarha M, Pendergraft J, Harrington J, Hirokawa KE, Harris JA, Nicovich PR, McGraw MJ, Ollerenshaw DR, Smith KA, Baker CA, Ting JT, Sunkin SM, Lecoq J, Lin MZ, Boyden ES, Murphy GJ, da Costa NM, Waters J, Li L, Tasic B, Zeng H. Cell. 2018 Jul 12;174(2):465-480.e22. doi: 10.1016/j.cell.2018.06.035. 10.1016/j.cell.2018.06.035 PubMed 30007418