Skip to main content

pBEAST-BenR
(Plasmid #114597)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 114597 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBEST-OR2-OR1-Pr-UTR1-deGFP-T500
  • Modifications to backbone
    Two 40bp spacers were added to the each end of the insert to facilitate Gibson assembly cloning into more complex constructs. Upstream and downstream terminators (B0014 and B0015, respectively) we also added, each flanked by two 40bp spacers. The OR2-OR1-Pr promoter and UTR were conserved, but deGFP was replaced by BenR.
  • Vector type
    Synthetic Biology ; Cell-Free Protein Synthesis

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BenR
  • Species
    Pseudomonas putida
  • Insert Size (bp)
    957
  • Promoter OR2-OR1-Pr

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACTATCGCACCATCAGCCAG
  • 3′ sequencing primer GGCACCTGTCCTACGAGTTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBEAST-BenR was a gift from Jerome Bonnet (Addgene plasmid # 114597 ; http://n2t.net/addgene:114597 ; RRID:Addgene_114597)
  • For your References section:

    Plug-and-play metabolic transducers expand the chemical detection space of cell-free biosensors. Voyvodic PL, Pandi A, Koch M, Conejero I, Valjent E, Courtet P, Renard E, Faulon JL, Bonnet J. Nat Commun. 2019 Apr 12;10(1):1697. doi: 10.1038/s41467-019-09722-9. 10.1038/s41467-019-09722-9 PubMed 30979906