-
Purposesuperfolder pHluorin for intracellular pH measurements in S. cerevisiae (improved performance when targeted to the ER or subsequent compartments)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 115697 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep246MET25
- Backbone size w/o insert (bp) 6271
- Total vector size (bp) 7129
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesfpHluorin
-
Alt namesuperfolder pHluorin
-
SpeciesAequorea victoria
-
Insert Size (bp)717
-
Mutationfor introduced mutations see publication
-
GenBank IDM62653.1
- Promoter MET25
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GCGTCTGTTAGAAAGGAAGTTTTTCC
- 3′ sequencing primer ACCTAGACTTCAGGTTGTC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p426MET25_sfpHluorin (MRV55) was a gift from Eckhard Boles (Addgene plasmid # 115697 ; http://n2t.net/addgene:115697 ; RRID:Addgene_115697) -
For your References section:
A superfolder variant of pH-sensitive pHluorin for in vivo pH measurements in the endoplasmic reticulum. Reifenrath M, Boles E. Sci Rep. 2018 Aug 10;8(1):11985. doi: 10.1038/s41598-018-30367-z. 10.1038/s41598-018-30367-z PubMed 30097598