-
PurposemiR-9 regulated GFP expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 115973 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLV
- Backbone size w/o insert (bp) 6475
- Total vector size (bp) 7897
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFPmiR9T
-
SpeciesSynthetic
-
Insert Size (bp)1422
- Promoter PGK
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer cctgtgttgccacctggatt
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV.PGK.GFP.miR9T was a gift from Johan Jakobsson (Addgene plasmid # 115973 ; http://n2t.net/addgene:115973 ; RRID:Addgene_115973) -
For your References section:
Visualization and genetic modification of resident brain microglia using lentiviral vectors regulated by microRNA-9. Akerblom M, Sachdeva R, Quintino L, Wettergren EE, Chapman KZ, Manfre G, Lindvall O, Lundberg C, Jakobsson J. Nat Commun. 2013;4:1770. doi: 10.1038/ncomms2801. 10.1038/ncomms2801 PubMed 23612311