-
PurposeTet-regulated (Tet-on) lentiviral vector for shGATA1 (hUbiquitin promoter) - 3rd generation
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 11650 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLVUT-tTR-KRAB
- Backbone size w/o insert (bp) 11876
-
Vector typeMammalian Expression, Lentiviral, RNAi, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsUse Stbl3 or HB101 to reduce chance of recombination. Grow at 37C
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehUbiquitin C, GFP, tTR-KRAB, shRNA against GATA1, Tet-on
-
Alt nameshRNA against GATA1
-
Alt nameGATCCCCGAAGCGCCTGATTGTCAGTTTCAAGAGAACTGACAATCAGGCGCTTCTTTTTGGAAA
-
Alt nameGATA1
-
SpeciesH. sapiens (human)
-
Entrez GeneGATA1 (a.k.a. ERYF1, GATA-1, GF-1, GF1, HAEADA, NF-E1, NFE1, XLANP, XLTDA, XLTT)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer See map
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Transgenes can be expressed from any RNA Pol II promoter as part of
bicistronic unit comprising the KRAB-based repressor; tetO sequences
are inserted into the vector LTR. Tet-on and Tet-off versions rely on
repressors that bind in the absence or the presence of doxycycline,
respectively. Addition of Pol III promoter-small hairpin RNA cassette
allows for drug-controllable RNA interference (Tet-on shRNA).
Please visit Trono lab website http://tronolab.epfl.ch to see frequently asked
questions on cloning strategies and packaging.
You may also visit LentiWeb http://www.lentiweb.com for discussion on cloning strategies and protocols.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLVUTHshGATA1-tTR-KRAB was a gift from Patrick Aebischer & Didier Trono (Addgene plasmid # 11650 ; http://n2t.net/addgene:11650 ; RRID:Addgene_11650) -
For your References section:
A versatile tool for conditional gene expression and knockdown. Szulc J, Wiznerowicz M, Sauvain MO, Trono D, Aebischer P. Nat Methods. 2006 Feb;3(2):109-16. doi: 10.1038/nmeth846 10.1038/nmeth846 PubMed 16432520