Skip to main content

pLVUTHshGATA1-tTR-KRAB
(Plasmid #11650)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 11650 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLVUT-tTR-KRAB
  • Backbone size w/o insert (bp) 11876
  • Vector type
    Mammalian Expression, Lentiviral, RNAi, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    Use Stbl3 or HB101 to reduce chance of recombination. Grow at 37C
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hUbiquitin C, GFP, tTR-KRAB, shRNA against GATA1, Tet-on
  • Alt name
    shRNA against GATA1
  • Alt name
    GATCCCCGAAGCGCCTGATTGTCAGTTTCAAGAGAACTGACAATCAGGCGCTTCTTTTTGGAAA
  • Alt name
    GATA1
  • Species
    H. sapiens (human)
  • Entrez Gene
    GATA1 (a.k.a. ERYF1, GATA-1, GF-1, GF1, HAEADA, NF-E1, NFE1, XLANP, XLTDA, XLTT)

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Transgenes can be expressed from any RNA Pol II promoter as part of
bicistronic unit comprising the KRAB-based repressor; tetO sequences
are inserted into the vector LTR. Tet-on and Tet-off versions rely on
repressors that bind in the absence or the presence of doxycycline,
respectively. Addition of Pol III promoter-small hairpin RNA cassette
allows for drug-controllable RNA interference (Tet-on shRNA).

Please visit Trono lab website http://tronolab.epfl.ch to see frequently asked
questions on cloning strategies and packaging.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLVUTHshGATA1-tTR-KRAB was a gift from Patrick Aebischer & Didier Trono (Addgene plasmid # 11650 ; http://n2t.net/addgene:11650 ; RRID:Addgene_11650)
  • For your References section:

    A versatile tool for conditional gene expression and knockdown. Szulc J, Wiznerowicz M, Sauvain MO, Trono D, Aebischer P. Nat Methods. 2006 Feb;3(2):109-16. doi: 10.1038/nmeth846 10.1038/nmeth846 PubMed 16432520