pXPR_BRD003 PSMB5 guide 2
(Plasmid
#117074)
-
Purposesingle guide RNA targeting PSMB5; guide 2
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 117074 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepXPR_BRD003
-
Backbone manufacturerBroad Institute
- Backbone size w/o insert (bp) 8318
- Total vector size (bp) 8318
-
Vector typeCRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLMPX
-
gRNA/shRNA sequenceTGAAGGGAACCGGATTTCAG
-
SpeciesH. sapiens (human)
-
GenBank IDNM_002797.4 NM_002797.4
-
Entrez GenePSMB5 (a.k.a. LMPX, MB1)
- Promoter hU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer GACTATCATATGCTTACCGT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXPR_BRD003 PSMB5 guide 2 was a gift from William Hahn (Addgene plasmid # 117074 ; http://n2t.net/addgene:117074 ; RRID:Addgene_117074) -
For your References section:
Renal medullary carcinomas depend upon SMARCB1 loss and are sensitive to proteasome inhibition. Hong AL, Tseng YY, Wala JA, Kim WJ, Kynnap BD, Doshi MB, Kugener G, Sandoval GJ, Howard TP, Li J, Yang X, Tillgren M, Ghandi M, Sayeed A, Deasy R, Ward A, McSteen B, Labella KM, Keskula P, Tracy A, Connor C, Clinton CM, Church AJ, Crompton BD, Janeway KA, Van Hare B, Sandak D, Gjoerup O, Bandopadhayay P, Clemons PA, Schreiber SL, Root DE, Gokhale PC, Chi SN, Mullen EA, Roberts CW, Kadoch C, Beroukhim R, Ligon KL, Boehm JS, Hahn WC. Elife. 2019 Mar 12;8. pii: 44161. doi: 10.7554/eLife.44161. 10.7554/eLife.44161 PubMed 30860482