Skip to main content
Addgene

pLKO.1-puro-U6-SpyCas9-TLR-MCV1-sgRNA2
(Plasmid #117406)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117406 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO.1-puro-U6
  • Backbone manufacturer
    Addgene#50920
  • Total vector size (bp) 7000
  • Modifications to backbone
    Added the sgRNA sequence of SpyCas9 targeting TLR2.0
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SpyCas9 sgRNA targeting TLR 2.0
  • Species
    Synthetic
  • Insert Size (bp)
    100
  • Promoter U6

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGTGACGTAGAAAGTAATAATTTC
  • 3′ sequencing primer CCTCGAGCCGCGGCCAAAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Derived from Addgene # 50920
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid contains an IS1 prokaryotic transposable element that does not affect plasmid function.

Please visit https://www.biorxiv.org/content/10.1101/864199v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1-puro-U6-SpyCas9-TLR-MCV1-sgRNA2 was a gift from Erik Sontheimer (Addgene plasmid # 117406 ; http://n2t.net/addgene:117406 ; RRID:Addgene_117406)
  • For your References section:

    Efficient Homology-Directed Repair with Circular Single-Stranded DNA Donors. Iyer S, Mir A, Vega-Badillo J, Roscoe BP, Ibraheim R, Zhu LJ, Lee J, Liu P, Luk K, Mintzer E, Guo D, Soares de Brito J, Emerson CP Jr, Zamore PD, Sontheimer EJ, Wolfe SA. CRISPR J. 2022 Oct;5(5):685-701. doi: 10.1089/crispr.2022.0058. Epub 2022 Sep 7. 10.1089/crispr.2022.0058 PubMed 36070530