pLKO.1-puro-U6-SpyCas9-TLR-MCV1-sgRNA2
(Plasmid
#117406)
-
PurposeSpyCas9 sgRNA 2 targeting TLR2.0
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117406 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLKO.1-puro-U6
-
Backbone manufacturerAddgene#50920
- Total vector size (bp) 7000
-
Modifications to backboneAdded the sgRNA sequence of SpyCas9 targeting TLR2.0
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpyCas9 sgRNA targeting TLR 2.0
-
SpeciesSynthetic
-
Insert Size (bp)100
- Promoter U6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGTGACGTAGAAAGTAATAATTTC
- 3′ sequencing primer CCTCGAGCCGCGGCCAAAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDerived from Addgene # 50920
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid contains an IS1 prokaryotic transposable element that does not affect plasmid function.
Please visit https://www.biorxiv.org/content/10.1101/864199v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1-puro-U6-SpyCas9-TLR-MCV1-sgRNA2 was a gift from Erik Sontheimer (Addgene plasmid # 117406 ; http://n2t.net/addgene:117406 ; RRID:Addgene_117406) -
For your References section:
Efficient Homology-Directed Repair with Circular Single-Stranded DNA Donors. Iyer S, Mir A, Vega-Badillo J, Roscoe BP, Ibraheim R, Zhu LJ, Lee J, Liu P, Luk K, Mintzer E, Guo D, Soares de Brito J, Emerson CP Jr, Zamore PD, Sontheimer EJ, Wolfe SA. CRISPR J. 2022 Oct;5(5):685-701. doi: 10.1089/crispr.2022.0058. Epub 2022 Sep 7. 10.1089/crispr.2022.0058 PubMed 36070530