-
PurposeExpression of tetracycline-inducible HA-tagged lysine-less mAID fused to lysine-less vhhGFP4 (mAID-nanobody)
-
Depositing Lab
-
Sequence Information
-
Sequences (2) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117713 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCDNA5 FRT/TO
-
Backbone manufacturerThermo Fisher Scientific
- Backbone size w/o insert (bp) 4850
- Total vector size (bp) 5561
-
Modifications to backboneHygromycin resistance exchanged to Neomycin
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemAID-nanobody
-
SpeciesSynthetic
-
Mutationcodon optimized mAID for murine expression
- Promoter CMV
-
Tag
/ Fusion Protein
- triple HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGGC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bycodon-optimized A. thaliana AID (IAA17) was obtained from Francis Stewart (TU Dresden, BIOTEC, Tatzberg 47-49, 01307 Dresden, Germany.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
codon-optimized A. thaliana AID (IAA17) is described in:
Baker, O. et al. RAC-tagging: Recombineering And Cas9-assisted targeting for protein tagging and conditional analyses. Sci Rep 6, 25529 (2016).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDNA5FRT/TO_HA-mAID-nanobody was a gift from Joerg Mansfeld (Addgene plasmid # 117713 ; http://n2t.net/addgene:117713 ; RRID:Addgene_117713) -
For your References section:
Conditional control of fluorescent protein degradation by an auxin-dependent nanobody. Daniel K, Icha J, Horenburg C, Muller D, Norden C, Mansfeld J. Nat Commun. 2018 Aug 17;9(1):3297. doi: 10.1038/s41467-018-05855-5. 10.1038/s41467-018-05855-5 [pii] PubMed 30120238