Skip to main content
Addgene

pIRES_IBB-mCherry-IRES-HA-mAID-nanobody
(Plasmid #117720)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117720 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pIRESpuro
  • Backbone manufacturer
    Thermo Fisher Scientific
  • Backbone size w/o insert (bp) 2539
  • Total vector size (bp) 6118
  • Modifications to backbone
    Puromycin resistance gene was exchanged with mAID-nanobody
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    mAID-nanobody
  • Species
    Synthetic
  • Insert Size (bp)
    714
  • Mutation
    codon optimized mAID for murine expression
  • Promoter None, IRES-driven
  • Tag / Fusion Protein
    • triple HA (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site XmaI (not destroyed)
  • 5′ sequencing primer CTTTACATGTGTTTAGTCGAGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGGC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    IBB-mCherry
  • Species
    Discosoma sp
  • Insert Size (bp)
    903
  • Promoter CMV
  • Tag / Fusion Protein
    • importin-beta bining domain (IBB) (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    codon-optimized A. thaliana AID (IAA17) was obtained from Francis Stewart (TU Dresden, BIOTEC, Tatzberg 47-49, 01307 Dresden, Germany

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

codon-optimized A. thaliana AID (IAA17) is described in:

Baker, O. et al. RAC-tagging: Recombineering And Cas9-assisted targeting for protein tagging and conditional analyses. Sci Rep 6, 25529 (2016).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIRES_IBB-mCherry-IRES-HA-mAID-nanobody was a gift from Joerg Mansfeld (Addgene plasmid # 117720 ; http://n2t.net/addgene:117720 ; RRID:Addgene_117720)
  • For your References section:

    Conditional control of fluorescent protein degradation by an auxin-dependent nanobody. Daniel K, Icha J, Horenburg C, Muller D, Norden C, Mansfeld J. Nat Commun. 2018 Aug 17;9(1):3297. doi: 10.1038/s41467-018-05855-5. 10.1038/s41467-018-05855-5 [pii] PubMed 30120238