pIRES_IBB-mCherry-IRES-HA-mAID-nanobody
(Plasmid
#117720)
-
PurposeExpression of nuclear transfection marker IBB-mCherry and HA-tagged mAID-nanobody from one mRNA
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117720 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepIRESpuro
-
Backbone manufacturerThermo Fisher Scientific
- Backbone size w/o insert (bp) 2539
- Total vector size (bp) 6118
-
Modifications to backbonePuromycin resistance gene was exchanged with mAID-nanobody
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namemAID-nanobody
-
SpeciesSynthetic
-
Insert Size (bp)714
-
Mutationcodon optimized mAID for murine expression
- Promoter None, IRES-driven
-
Tag
/ Fusion Protein
- triple HA (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site XmaI (not destroyed)
- 5′ sequencing primer CTTTACATGTGTTTAGTCGAGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGGC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameIBB-mCherry
-
SpeciesDiscosoma sp
-
Insert Size (bp)903
- Promoter CMV
-
Tag
/ Fusion Protein
- importin-beta bining domain (IBB) (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bycodon-optimized A. thaliana AID (IAA17) was obtained from Francis Stewart (TU Dresden, BIOTEC, Tatzberg 47-49, 01307 Dresden, Germany
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
codon-optimized A. thaliana AID (IAA17) is described in:
Baker, O. et al. RAC-tagging: Recombineering And Cas9-assisted targeting for protein tagging and conditional analyses. Sci Rep 6, 25529 (2016).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIRES_IBB-mCherry-IRES-HA-mAID-nanobody was a gift from Joerg Mansfeld (Addgene plasmid # 117720 ; http://n2t.net/addgene:117720 ; RRID:Addgene_117720) -
For your References section:
Conditional control of fluorescent protein degradation by an auxin-dependent nanobody. Daniel K, Icha J, Horenburg C, Muller D, Norden C, Mansfeld J. Nat Commun. 2018 Aug 17;9(1):3297. doi: 10.1038/s41467-018-05855-5. 10.1038/s41467-018-05855-5 [pii] PubMed 30120238