pLenti CMV TRE3G Neo GFP-Progerin C661S
              
              
                (Plasmid
                
                #118711)
              
            
            
            
          - 
            PurposeLentiviral TET-ON inducible GFP-Progerin C661S (Farnesylation mutant)
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 118711 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepLenti CMV TRE3G Neomycin
- 
              Backbone manufacturerEric Campeau
- Backbone size w/o insert (bp) 8013
- Total vector size (bp) 10645
- 
              Vector typeMammalian Expression, Lentiviral ; TET-ON inducible
- 
                Selectable markersNeomycin (select with G418)
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature30°C
- 
            Growth Strain(s)NEB Stable
- 
              Growth instructionsConstruct may be grown in DH5A cells, and or 37 degrees, though STBL3 and 30 degrees are recommended to reduce chance of recombination events.
- 
            Copy numberUnknown
Gene/Insert
- 
                Gene/Insert nameGFP-Progerin C661S
- 
                  Alt nameProgerin C661S
- 
                    SpeciesH. sapiens (human)
- 
                  Insert Size (bp)2632
- 
                  MutationC661S farnesylation mutant
- 
                    GenBank IDENSG00000160789
- 
                        Entrez GeneLMNA (a.k.a. CDCD1, CDDC, CMD1A, CMT2B1, EMD2, FPL, FPLD, FPLD2, HGPS, IDC, LDP1, LFP, LGMD1B, LMN1, LMNC, LMNL1, MADA, PRO1)
- Promoter CMV TRE3G (TET-ON)
- 
    
        Tag
        / Fusion Protein
    - GFP (N terminal on insert)
 
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer tgaccagtttactccctatcagtg
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
To generate mammalian inducible cell lines co-infect with  lentivirus made from:  
pLenti CMV rtTA3 Hygro (w785-1)( Addgene Plasmid #26730)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pLenti CMV TRE3G Neo GFP-Progerin C661S was a gift from Tom Misteli (Addgene plasmid # 118711 ; http://n2t.net/addgene:118711 ; RRID:Addgene_118711)
- 
                For your References section: A high-content imaging-based screening pipeline for the systematic identification of anti-progeroid compounds. Kubben N, Brimacombe KR, Donegan M, Li Z, Misteli T. Methods. 2015 Sep 1. pii: S1046-2023(15)30070-0. doi: 10.1016/j.ymeth.2015.08.024. 10.1016/j.ymeth.2015.08.024 PubMed 26341717
