pAAV-HyPer3
(Plasmid
#119183)
-
PurposeAAV expression vector with CMV promoter driving expression of the hydrogen peroxide-sensitive fluorescent biosensor HyPer3.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 119183 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-MCS
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4600
- Total vector size (bp) 6000
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHyPer3
-
Insert Size (bp)1437
- Promoter CMV
-
Tag
/ Fusion Protein
- None
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (destroyed during cloning)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer TTATCTTCCTCCCACAGCTCC
- 3′ sequencing primer TGGAGTGGCAACTTCCAGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byHyPer3 was originally created by Vsevolod Belousov's laboratory.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Can be used for in vivo expression of the hydrogen peroxide-sensitive fluorescent protein HyPer3. It was used for this purpose in Steinhorn et al. Free Radic Biol Med. 2017 Dec;113:16-25. doi: 10.1016/j.freeradbiomed.2017.09.006.
In the associated publication (Steinhorn et al. Nat Commun. 2018 Oct 2;9(1):4044. doi: 10.1038/s41467-018-06533-2), it was used as a control for a virus driving expression of a fusion between HyPer and D-amino acid oxidase.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-HyPer3 was a gift from Thomas Michel (Addgene plasmid # 119183 ; http://n2t.net/addgene:119183 ; RRID:Addgene_119183) -
For your References section:
Chemogenetic generation of hydrogen peroxide in the heart induces severe cardiac dysfunction. Steinhorn B, Sorrentino A, Badole S, Bogdanova Y, Belousov V, Michel T. Nat Commun. 2018 Oct 2;9(1):4044. doi: 10.1038/s41467-018-06533-2. 10.1038/s41467-018-06533-2 PubMed 30279532