-
Purpose(Empty Backbone) Allows Gateway cloning of gene of interest into retroviral pMSCV vector (with Puromycin resistance)
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 119745 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMSCVpuro
-
Backbone manufacturerClontech
- Backbone size (bp) 6300
-
Modifications to backboneRfB Gateway cassette cloned into pMSCVpuro HpaI site
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer pMSCV-5' - CCCTTGAACCTCCTCGTTCGACC
- 3′ sequencing primer pMSCV-3' - GAGACGTGCTACTTCCATTTGTC
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCVpuro-DEST was a gift from Andrew Jackson & Martin Reijns (Addgene plasmid # 119745 ; http://n2t.net/addgene:119745 ; RRID:Addgene_119745) -
For your References section:
RNase H2, mutated in Aicardi-Goutieres syndrome, promotes LINE-1 retrotransposition. Benitez-Guijarro M, Lopez-Ruiz C, Tarnauskaite Z, Murina O, Mian Mohammad M, Williams TC, Fluteau A, Sanchez L, Vilar-Astasio R, Garcia-Canadas M, Cano D, Kempen MH, Sanchez-Pozo A, Heras SR, Jackson AP, Reijns MA, Garcia-Perez JL. EMBO J. 2018 Aug 1;37(15). pii: embj.201798506. doi: 10.15252/embj.201798506. Epub 2018 Jun 29. 10.15252/embj.201798506 PubMed 29959219