Skip to main content
Addgene

pMSCVpuro-DEST
(Plasmid #119745)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 119745 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMSCVpuro
  • Backbone manufacturer
    Clontech
  • Backbone size (bp) 6300
  • Modifications to backbone
    RfB Gateway cassette cloned into pMSCVpuro HpaI site
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer pMSCV-5' - CCCTTGAACCTCCTCGTTCGACC
  • 3′ sequencing primer pMSCV-3' - GAGACGTGCTACTTCCATTTGTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSCVpuro-DEST was a gift from Andrew Jackson & Martin Reijns (Addgene plasmid # 119745 ; http://n2t.net/addgene:119745 ; RRID:Addgene_119745)
  • For your References section:

    RNase H2, mutated in Aicardi-Goutieres syndrome, promotes LINE-1 retrotransposition. Benitez-Guijarro M, Lopez-Ruiz C, Tarnauskaite Z, Murina O, Mian Mohammad M, Williams TC, Fluteau A, Sanchez L, Vilar-Astasio R, Garcia-Canadas M, Cano D, Kempen MH, Sanchez-Pozo A, Heras SR, Jackson AP, Reijns MA, Garcia-Perez JL. EMBO J. 2018 Aug 1;37(15). pii: embj.201798506. doi: 10.15252/embj.201798506. Epub 2018 Jun 29. 10.15252/embj.201798506 PubMed 29959219