-
PurposeReporter gene with five ATF6 sites that is highly sensitive to ER stress
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 11976 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepOFluc-GL3
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name5xATF6 binding site
-
Tags
/ Fusion Proteins
- Luc (C terminal on backbone)
- c-fos promoter (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer NA (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
5 repeats of the ATF6 oligonucleotides were cloned into pOFluc-GL3 at an XhoI site 5' to the c-fos minimal promoter (-53 to +45 of the human c-fos promoter) and the firefly luciferase gene. See author's map for detail.
Oligo seq is - 5'- TCGAGACAGGTGCTGACGTGGCGATTCC
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p5xATF6-GL3 was a gift from Ron Prywes (Addgene plasmid # 11976 ; http://n2t.net/addgene:11976 ; RRID:Addgene_11976) -
For your References section:
Activation of ATF6 and an ATF6 DNA binding site by the endoplasmic reticulum stress response. Wang Y, Shen J, Arenzana N, Tirasophon W, Kaufman RJ, Prywes R. J Biol Chem. 2000 Sep 1. 275(35):27013-20. 10.1074/jbc.M003322200 PubMed 10856300