Skip to main content

pAH235
(Plasmid #121145)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 121145 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSLF273
  • Backbone size w/o insert (bp) 8460
  • Total vector size (bp) 12736
  • Vector type
    Yeast Expression, CRISPR
  • Selectable markers
    S.pombe ura4

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    humanized Streptococcus pyogenes Cas9
  • Species
    Synthetic
  • Insert Size (bp)
    4276
  • Promoter nmt41
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho I (destroyed during cloning)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer TCTCACTTTCTGACTTATAGTCGCT
  • 3′ sequencing primer AGCAGTACTGGCAAGGGAGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Ran, F.A., Hsu, P.D.P., Wright, J., Agarwala, V., Scott, D. a and Zhang, F. (2013) Genome engineering using the CRISPR-Cas9 system. Nat. Protoc., 8, 2281–2308. After prepping the DNA, it is recommended to heat the DNA to 65C before digesting with Bbs I. Supplementary data is available at Figshare: https://doi.org/10.25387/g3.7685642.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAH235 was a gift from Katsunori Tanaka (Addgene plasmid # 121145 ; http://n2t.net/addgene:121145 ; RRID:Addgene_121145)
  • For your References section:

    Short-Homology-Mediated CRISPR/Cas9-Based Method for Genome Editing in Fission Yeast. Hayashi A, Tanaka K. G3 (Bethesda). 2019 Feb 12. pii: g3.118.200976. doi: 10.1534/g3.118.200976. 10.1534/g3.118.200976 PubMed 30755408