pAH237
(Plasmid
#121146)
-
PurposeExpression of both nmt41p-cas9 and rrk1p-gRNA (LEU2 marker) for CRISPR genome editing in fission yeast
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 121146 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAH233
- Backbone size w/o insert (bp) 8996
- Total vector size (bp) 15440
-
Modifications to backboneno BbsI site in LEU2 marker gene
-
Vector typeYeast Expression, CRISPR
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namegRNA cassette
-
SpeciesS. pombe (fission yeast), Synthetic
- Promoter S.pombe rrk1
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site PstI (destroyed during cloning)
- 3′ cloning site SacI (destroyed during cloning)
- 5′ sequencing primer CACACATGAACAAGGAAGTACAGG
- 3′ sequencing primer CAGATAAGTCACTATGTCCGAGTG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namehumanized Streptococcus pyogenes Cas9
-
SpeciesS. pombe (fission yeast), Synthetic
-
Insert Size (bp)6439
- Promoter nmt41
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (destroyed during cloning)
- 3′ cloning site NcoI (destroyed during cloning)
- 5′ sequencing primer TCTCACTTTCTGACTTATAGTCGCT
- 3′ sequencing primer GATCACCATCATGGAAAGAAGCAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Ran, F.A., Hsu, P.D.P., Wright, J., Agarwala, V., Scott, D. a and Zhang, F. (2013) Genome engineering using the CRISPR-Cas9 system. Nat. Protoc., 8, 2281–2308.
Jacobs, J.Z., Ciccaglione, K.M., Tournier, V. and Zaratiegui, M. (2014) Implementation of the CRISPR-Cas9 system in fission yeast. Nat. Commun., 5, 5344. After prepping the DNA, it is recommended to heat the DNA to 65C before digesting with Bbs I. Supplementary data is available at Figshare: https://doi.org/10.25387/g3.7685642.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAH237 was a gift from Katsunori Tanaka (Addgene plasmid # 121146 ; http://n2t.net/addgene:121146 ; RRID:Addgene_121146) -
For your References section:
Short-Homology-Mediated CRISPR/Cas9-Based Method for Genome Editing in Fission Yeast. Hayashi A, Tanaka K. G3 (Bethesda). 2019 Feb 12. pii: g3.118.200976. doi: 10.1534/g3.118.200976. 10.1534/g3.118.200976 PubMed 30755408