Skip to main content

pLenti-EF1alpha-IRES-EGFP-HA-hNPHP1
(Plasmid #122874)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 122874 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti-EF1α-IRES-EGFP
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human NPHP1
  • Species
    H. sapiens (human)
  • Entrez Gene
    NPHP1 (a.k.a. JBTS4, NPH1, SLSN1)
  • Promoter EF1 alpha
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SfiI (not destroyed)
  • 3′ cloning site SfiI (unknown if destroyed)
  • 5′ sequencing primer TTCTCAAGCCTCAGACAGTG
  • 3′ sequencing primer AAGCGGCTTCGGCCAGTAAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-EF1alpha-IRES-EGFP-HA-hNPHP1 was a gift from FENG-QIAN Li & Ken-Ichi Takemaru (Addgene plasmid # 122874 ; http://n2t.net/addgene:122874 ; RRID:Addgene_122874)