-
PurposeGene knockout/in for actinomycetes
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 125688 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGM1190
- Backbone size w/o insert (bp) 6971
-
Vector typeCRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Apramycin, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namestreptomyces codon optimized spCas9, sgRNA casette, and ScaligD
-
gRNA/shRNA sequenceGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT
-
SpeciesOther
- Promoter ermE*/tipA
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer Unknown
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that an IS1 transposase sequence was found downstream of Cas9 during Addgene's quality control. The depositor noted that this sequence should NOT affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRISPR-Cas9-ScaligD was a gift from Tilmann Weber (Addgene plasmid # 125688 ; http://n2t.net/addgene:125688 ; RRID:Addgene_125688) -
For your References section:
CRISPR-Cas9 Based Engineering of Actinomycetal Genomes. Tong Y, Charusanti P, Zhang L, Weber T, Lee SY. ACS Synth Biol. 2015 Sep 18;4(9):1020-9. doi: 10.1021/acssynbio.5b00038. Epub 2015 Apr 7. 10.1021/acssynbio.5b00038 PubMed 25806970