pDmelOR
(Plasmid
#126476)
-
PurposeVector for the functional expression of insect ORs in mammalian cells, with a human codon-optimized version of D.melanogaster Orco (hOrco) with an N-terminal myc tag and a β-globin/IgG chimeric intron
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 126476 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV-BI
- Backbone size w/o insert (bp) 4111
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDmelOrco
-
Alt nameOrco
-
Alt nameOdorant receptor co-receptor
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)1509
-
Mutationcodon optimization for H. sapiens; includes a recombinant β-globin/IgG chimeric intron to inhibit its functional expression in bacteria
-
Entrez GeneOrco (a.k.a. Dmel_CG10609, 83A.2, 83b, A45, CG10609, DOR45, DOR83b, DmORCO, DmOrco, DmelOrco, Dmel\CG10609, OR49, OR83B, OR83b, ORCO, Or83b, OrCo, or83b, orco, vainsA)
- Promoter CMV
-
Tag
/ Fusion Protein
- Myc (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GTGTACGGTGGGAGGTCTATATAAG
- 3′ sequencing primer GTGGTATGGCTGATTATGATCCTCT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Is it recommended to digest the vector with XhoI and PvuI-HF and gel purify the two bands before sequencing as the two CMV promoters and SV40-polyA sequences are very similar to each other. Use the EcoRI restriction site for best functional expression on the MCS2. Please visit https://www.biorxiv.org/content/10.1101/669127v1 for BioRxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDmelOR was a gift from Bill Hansson (Addgene plasmid # 126476 ; http://n2t.net/addgene:126476 ; RRID:Addgene_126476) -
For your References section:
Optimization of Insect Odorant Receptor Trafficking and Functional Expression Via Transient Transfection in HEK293 Cells. Miazzi F, Hoyer C, Sachse S, Knaden M, Wicher D, Hansson BS, Lavista-Llanos S. Chem Senses. 2019 Oct 26;44(9):673-682. doi: 10.1093/chemse/bjz062. 10.1093/chemse/bjz062 PubMed 31504297