pES133
(Plasmid
#127552)
-
PurposeVariant of pKD13. Lambda Red recombineering PCR template plasmid carrying an F5-tetA-F5 cassette orthogonal to FRT-KanR-FRT in pKD13
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127552 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepKD13
-
Backbone manufacturerKEIO collection material
- Backbone size w/o insert (bp) 2000
- Total vector size (bp) 3522
-
Modifications to backboneNone - except that the backbone was PCR-amplified and not re-squenced
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Pir1
-
Growth instructionsThe plasmid is stable and can be selected on sole ampiciliin
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameF5-flanked tetracycline resistance cassette
-
Alt nameF5-tetA-F5
-
SpeciesSynthetic; pBR322
-
Insert Size (bp)1400
-
MutationMultiple SNPs in tetA (originally from pBR322) to suppress a number of restriction sites
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer cctcgctttgtaacggagtagag
- 3′ sequencing primer gacggatggcctttttgcgtggc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pES133 was a gift from Emmanuele Severi & Gavin Thomas (Addgene plasmid # 127552 ; http://n2t.net/addgene:127552 ; RRID:Addgene_127552)