Skip to main content

pES133
(Plasmid #127552)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127552 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pKD13
  • Backbone manufacturer
    KEIO collection material
  • Backbone size w/o insert (bp) 2000
  • Total vector size (bp) 3522
  • Modifications to backbone
    None - except that the backbone was PCR-amplified and not re-squenced
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Pir1
  • Growth instructions
    The plasmid is stable and can be selected on sole ampiciliin
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    F5-flanked tetracycline resistance cassette
  • Alt name
    F5-tetA-F5
  • Species
    Synthetic; pBR322
  • Insert Size (bp)
    1400
  • Mutation
    Multiple SNPs in tetA (originally from pBR322) to suppress a number of restriction sites

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer cctcgctttgtaacggagtagag
  • 3′ sequencing primer gacggatggcctttttgcgtggc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pES133 was a gift from Emmanuele Severi & Gavin Thomas (Addgene plasmid # 127552 ; http://n2t.net/addgene:127552 ; RRID:Addgene_127552)