-
PurposeHypoxia response element real-time luciferase reporter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128095 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGL4.22
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 5566
- Total vector size (bp) 5647
-
Modifications to backboneinsertion of the PGK1 HRE (x3) into promoter region
-
Vector typeMammalian Expression, Luciferase
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsThe depositing lab used Top10 in their studies.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHypoxia response element (x3) from PGK1 promoter
-
Alt nameHRE (x3)
-
Alt nameHIF response element (x3)
-
Alt namephosphoglycerate kinase 1 hypoxia response element (x3)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)79
-
GenBank IDNM_000291
-
Entrez GenePGK1 (a.k.a. HEL-S-68p, MIG10, PGKA)
- Promoter inserted PGK1 hypoxia response elements (HRE) (x3)
-
Tag
/ Fusion Protein
- drives expression of destabilized luciferase (2CP) for real-time HRE activity assessment (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer RVprimer3: CTAGCAAAATAGGCTGTCCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byHRE-pGL2-TK (Li et al., 2014; Celeste Simon Lab) and pGL4.22 (Promega)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL4.22-PGK1-HRE::dLUC was a gift from Chi Van Dang (Addgene plasmid # 128095 ; http://n2t.net/addgene:128095 ; RRID:Addgene_128095) -
For your References section:
Acid Suspends the Circadian Clock in Hypoxia through Inhibition of mTOR. Walton ZE, Patel CH, Brooks RC, Yu Y, Ibrahim-Hashim A, Riddle M, Porcu A, Jiang T, Ecker BL, Tameire F, Koumenis C, Weeraratna AT, Welsh DK, Gillies R, Alwine JC, Zhang L, Powell JD, Dang CV. Cell. 2018 Jun 28;174(1):72-87.e32. doi: 10.1016/j.cell.2018.05.009. Epub 2018 May 31. 10.1016/j.cell.2018.05.009 PubMed 29861175