pDT305
(Plasmid
#128801)
-
PurposeHuman codon optimized dCas9-Dnmt3a-Dnmt3l-T2A-eGFP + gRNA expression cassette + LV backbone
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128801 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDT305
- Backbone size w/o insert (bp) 5592
- Total vector size (bp) 16000
-
Vector typeLentiviral, CRISPR
-
Selectable markerseGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedCas9-Dnmt3a-Dnmt3l-T2A-eGFP + gRNA expression cassette + LV backbone
-
SpeciesH. sapiens (human)
-
Insert Size (bp)10408
- Promoter hUBC promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TGAAGCTCCGGTTTTGAACT
- 3′ sequencing primer CATGTTAGAAGACTTCCTCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDT305 was a gift from Bradley Bernstein (Addgene plasmid # 128801 ; http://n2t.net/addgene:128801 ; RRID:Addgene_128801) -
For your References section:
Epigenome editing strategies for the functional annotation of CTCF insulators. Tarjan DR, Flavahan WA, Bernstein BE. Nat Commun. 2019 Sep 18;10(1):4258. doi: 10.1038/s41467-019-12166-w. 10.1038/s41467-019-12166-w PubMed 31534142