Skip to main content
Addgene

pSK267
(Plasmid #129272)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 129272 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGAN147
  • Backbone manufacturer
    Gregory Newby
  • Total vector size (bp) 8954
  • Vector type
    Yeast Expression
  • Selectable markers
    Nourseothricin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NLS-VP16-ZF 43-8-NES
  • Species
    Synthetic
  • Promoter SUP35
  • Tag / Fusion Protein
    • 6xHA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (destroyed during cloning)
  • 3′ cloning site HindIII (destroyed during cloning)
  • 5′ sequencing primer catcttctcttgaaagactccattgtactg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This is the zinc finger only control for the yTRAP sensor plasmid. Linearize with NotI-HF enzyme prior to integration into the yeast genome. pSK267 integrates into the HO locus, and can be selected for using nourseothricin, it constitutively produces high mNeonGreen reporter output.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSK267 was a gift from Ahmad Khalil (Addgene plasmid # 129272 ; http://n2t.net/addgene:129272 ; RRID:Addgene_129272)
  • For your References section:

    A Genetic Tool to Track Protein Aggregates and Control Prion Inheritance. Newby GA, Kiriakov S, Hallacli E, Kayatekin C, Tsvetkov P, Mancuso CP, Bonner JM, Hesse WR, Chakrabortee S, Manogaran AL, Liebman SW, Lindquist S, Khalil AS. Cell. 2017 Nov 2;171(4):966-979.e18. doi: 10.1016/j.cell.2017.09.041. Epub 2017 Oct 19. 10.1016/j.cell.2017.09.041 PubMed 29056345