pSK267
(Plasmid
#129272)
-
Purpose"ZF only" yTRAP control to control for yTRAP reporter fluorescence changes not dependent on sensed protein
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 129272 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGAN147
-
Backbone manufacturerGregory Newby
- Total vector size (bp) 8954
-
Vector typeYeast Expression
-
Selectable markersNourseothricin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNLS-VP16-ZF 43-8-NES
-
SpeciesSynthetic
- Promoter SUP35
-
Tag
/ Fusion Protein
- 6xHA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (destroyed during cloning)
- 3′ cloning site HindIII (destroyed during cloning)
- 5′ sequencing primer catcttctcttgaaagactccattgtactg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This is the zinc finger only control for the yTRAP sensor plasmid. Linearize with NotI-HF enzyme prior to integration into the yeast genome. pSK267 integrates into the HO locus, and can be selected for using nourseothricin, it constitutively produces high mNeonGreen reporter output.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSK267 was a gift from Ahmad Khalil (Addgene plasmid # 129272 ; http://n2t.net/addgene:129272 ; RRID:Addgene_129272) -
For your References section:
A Genetic Tool to Track Protein Aggregates and Control Prion Inheritance. Newby GA, Kiriakov S, Hallacli E, Kayatekin C, Tsvetkov P, Mancuso CP, Bonner JM, Hesse WR, Chakrabortee S, Manogaran AL, Liebman SW, Lindquist S, Khalil AS. Cell. 2017 Nov 2;171(4):966-979.e18. doi: 10.1016/j.cell.2017.09.041. Epub 2017 Oct 19. 10.1016/j.cell.2017.09.041 PubMed 29056345