pAH-CTX1-rhadCas9-native
(Plasmid
#129392)
-
PurposeDerived from pAH-CTX1-rha. The native Streptococcus pyogenes dCas9 gene cloned downstream of PrhaBAD. Non-codon-optimized dCas9 version of pAH-CTX1-rhadCas9.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 129392 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAH-CTX1-rha
-
Backbone manufacturerAndrew Hogan
- Backbone size w/o insert (bp) 7649
- Total vector size (bp) 11897
-
Modifications to backboneInsertion of Streptococcus pyogenes dCas9
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameS. pyogenes dCas9
-
SpeciesS. pyogenes
-
Insert Size (bp)4248
-
MutationAspartate 10 to Alanine, Histidine 840 to Alanine
-
GenBank IDAE004092.2
- Promoter PrhaBAD
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GGGTTCTATCGCCACGGAC
- 3′ sequencing primer CTTCCGCTGTCTCTCCACTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bydCas9 designed for S. pyogenes was cloned by Qi et al. (2013). The plasmid, 44249, was distributed by Addgene.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAH-CTX1-rhadCas9-native was a gift from Silvia Cardona (Addgene plasmid # 129392 ; http://n2t.net/addgene:129392 ; RRID:Addgene_129392) -
For your References section:
A broad-host-range CRISPRi toolkit for silencing gene expression in Burkholderia. Hogan AM, Rahman ASMZ, Lightly TJ, Cardona ST. ACS Synth Biol. 2019 Sep 6. doi: 10.1021/acssynbio.9b00232. 10.1021/acssynbio.9b00232 PubMed 31491085