-
PurposeTemplate plasmid for guide sequence insertion via inverse PCR. Derived from pSCrhaB2-gRNA (see paper).
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 129463 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSCrhaB2
-
Backbone manufacturerMiguel Valvano and Silvia Cardona
- Backbone size w/o insert (bp) 5451
- Total vector size (bp) 5601
-
Modifications to backboneRemoval of RhaS, RhaR, and truncation of PrhaBAD. Addition of gRNA scaffold under the control of the J23119 promoter. Restriction cloning used to insert scaffold from pgRNA-bacteria.
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Trimethoprim, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namepgRNA
-
gRNA/shRNA sequenceAACTTTCAGTTTAGCGGTCT
-
SpeciesSynthetic
-
GenBank IDMH319949.1
- Promoter BBa_J23119 (SpeI)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer TAAGATggatccTCAGTTGGCTTCATCGCTAC
- 3′ sequencing primer CCGCCAGGCAAATTCTGTTT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Original sgRNA under control of J23119 promoter constructed by Lei Qi et al. (2013). Recognizes intergenic region in E. coli.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSCB2-sgRNA was a gift from Silvia Cardona (Addgene plasmid # 129463 ; http://n2t.net/addgene:129463 ; RRID:Addgene_129463) -
For your References section:
A broad-host-range CRISPRi toolkit for silencing gene expression in Burkholderia. Hogan AM, Rahman ASMZ, Lightly TJ, Cardona ST. ACS Synth Biol. 2019 Sep 6. doi: 10.1021/acssynbio.9b00232. 10.1021/acssynbio.9b00232 PubMed 31491085