Skip to main content

pSCB2-sgRNA
(Plasmid #129463)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 129463 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSCrhaB2
  • Backbone manufacturer
    Miguel Valvano and Silvia Cardona
  • Backbone size w/o insert (bp) 5451
  • Total vector size (bp) 5601
  • Modifications to backbone
    Removal of RhaS, RhaR, and truncation of PrhaBAD. Addition of gRNA scaffold under the control of the J23119 promoter. Restriction cloning used to insert scaffold from pgRNA-bacteria.
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Trimethoprim, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    pgRNA
  • gRNA/shRNA sequence
    AACTTTCAGTTTAGCGGTCT
  • Species
    Synthetic
  • GenBank ID
    MH319949.1
  • Promoter BBa_J23119 (SpeI)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer TAAGATggatccTCAGTTGGCTTCATCGCTAC
  • 3′ sequencing primer CCGCCAGGCAAATTCTGTTT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Original sgRNA under control of J23119 promoter constructed by Lei Qi et al. (2013). Recognizes intergenic region in E. coli.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSCB2-sgRNA was a gift from Silvia Cardona (Addgene plasmid # 129463 ; http://n2t.net/addgene:129463 ; RRID:Addgene_129463)
  • For your References section:

    A broad-host-range CRISPRi toolkit for silencing gene expression in Burkholderia. Hogan AM, Rahman ASMZ, Lightly TJ, Cardona ST. ACS Synth Biol. 2019 Sep 6. doi: 10.1021/acssynbio.9b00232. 10.1021/acssynbio.9b00232 PubMed 31491085