pgRNA-non-target
(Plasmid
#129465)
-
PurposeDerived from pSCB2-sgRNA. 20 nucleotide sequence added as sgRNA binding region by inverse PCR. Used as a negative control.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 129465 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSCrhaB2
-
Backbone manufacturerMiguel Valvano and Silvia Cardona
- Backbone size w/o insert (bp) 5451
- Total vector size (bp) 5601
-
Modifications to backbonepSCB2-sgRNA is the actual vector backbone. Rhamnose-inducible promoter system removed via inverse PCR. Additional inverse PCR to insert random 20 nucleotides as a negative control for no binding of sgRNA to DNA of bacteria.
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Trimethoprim, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNon-target/random gRNA
-
gRNA/shRNA sequenceCGACGAATGCCAAGCAGATA
-
SpeciesSynthetic
-
GenBank IDMH319949.1
- Promoter BBa_J23119 (SpeI)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAAGATggatccTCAGTTGGCTTCATCGCTAC
- 3′ sequencing primer CCGCCAGGCAAATTCTGTTT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bygRNA scaffold was constructed by Qi et al. (2013). Binding sequence (20 nt) was constructed by IDT, ligated in lab.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Synthetic guide RNA was designed such that it did not bind anywhere on the B. cenocepacia chromosome.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pgRNA-non-target was a gift from Silvia Cardona (Addgene plasmid # 129465 ; http://n2t.net/addgene:129465 ; RRID:Addgene_129465) -
For your References section:
A broad-host-range CRISPRi toolkit for silencing gene expression in Burkholderia. Hogan AM, Rahman ASMZ, Lightly TJ, Cardona ST. ACS Synth Biol. 2019 Sep 6. doi: 10.1021/acssynbio.9b00232. 10.1021/acssynbio.9b00232 PubMed 31491085