-
PurposeExpression of a Streptomyces codon optimized Cas9n-tadA fusion protein in pGM1190. A to G base editor for actinomycetes
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 131464 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGM1190
- Backbone size w/o insert (bp) 6971
- Total vector size (bp) 12452
-
Vector typeCRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Apramycin, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameStreptomyces codon optimized spCas9n (D10A)
-
SpeciesSynthetic; Streptomyces
-
Insert Size (bp)4104
-
GenBank IDKR011748
- Promoter tipA
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer gcggcagcagcggcggctcggacaagaagtactccatcgg
- 3′ sequencing primer ggggatcctctagaaagctttcagtcgccgccgagctggg (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namestreptomyces codon optimized tadA
-
SpeciesSynthetic; Streptomyces
-
Insert Size (bp)1191
- Promoter tipA
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAGAGAAGGGAGCGGACAtatgagcgaggtcgagttctc
- 3′ sequencing primer cgagccgccgctgctgccgc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRISPR-aBEST was a gift from Tilmann Weber (Addgene plasmid # 131464 ; http://n2t.net/addgene:131464 ; RRID:Addgene_131464) -
For your References section:
Highly efficient DSB-free base editing for streptomycetes with CRISPR-BEST. Tong Y, Whitford CM, Robertsen HL, Blin K, Jorgensen TS, Klitgaard AK, Gren T, Jiang X, Weber T, Lee SY. Proc Natl Acad Sci U S A. 2019 Oct 8;116(41):20366-20375. doi: 10.1073/pnas.1913493116. Epub 2019 Sep 23. 10.1073/pnas.1913493116 PubMed 31548381