Skip to main content
Addgene

SuperNova-TGON3
(Plasmid #131859)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 131859 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1(+)
  • Backbone manufacturer
    Invitrogen
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SuperNova
  • Species
    Synthetic
  • Promoter CMV
  • Tag / Fusion Protein
    • TGON3 (rat) (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Trans-Golgi network targeting was achieved by inserting synthetic DNA coding for TGON3 (rat) with N-terminal SuperNova into pcDNA3.1(+) using restriction sites NheI and XbaI. SuperNova sequence is from: Takemoto, K.; Matsuda, T.; Sakai, N.; Fu, D.; Noda, M.; Uchiyama, S.; Kotera, I.; Arai, Y.; Horiuchi, M.; Fukui, K.; et al. SuperNova, a monomeric photosensitizing fluorescent protein for chromophore-assisted light inactivation. Sci. Rep. 2013, 3, 2629.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SuperNova-TGON3 was a gift from Geert van den Bogaart (Addgene plasmid # 131859 ; http://n2t.net/addgene:131859 ; RRID:Addgene_131859)
  • For your References section:

    Radical Stress Is More Cytotoxic in the Nucleus than in Other Organelles. Paardekooper LM, van Vroonhoven E, Ter Beest M, van den Bogaart G. Int J Mol Sci. 2019 Aug 25;20(17). pii: ijms20174147. doi: 10.3390/ijms20174147. 10.3390/ijms20174147 PubMed 31450682