Skip to main content

Raichu-OsRac1 WT
(Plasmid #133262)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 133262 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBI221
  • Vector type
    Plant Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    OsRac1
  • Species
    Oryza sativa
  • Entrez Gene
    LOC4325879 (a.k.a. OSNPB_010229400, OsRac1, Rac1)
  • Promoter Ubi
  • Tags / Fusion Proteins
    • Venus-CRIB (N terminal on insert)
    • CFP-lipid (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer pBI221 35S: ACTGACGTAAGGGATGACGC
  • 3′ sequencing primer NosTer R 2: GATAATCATCGCAAGACCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Raichu-OsRac1 WT was a gift from Yoji Kawano (Addgene plasmid # 133262 ; http://n2t.net/addgene:133262 ; RRID:Addgene_133262)
  • For your References section:

    In vivo monitoring of plant small GTPase activation using a Forster resonance energy transfer biosensor. Wong HL, Akamatsu A, Wang Q, Higuchi M, Matsuda T, Okuda J, Kosami KI, Inada N, Kawasaki T, Kaneko-Kawano T, Nagawa S, Tan L, Kawano Y, Shimamoto K. Plant Methods. 2018 Jul 7;14:56. doi: 10.1186/s13007-018-0325-4. eCollection 2018. 10.1186/s13007-018-0325-4 PubMed 30002723