Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRRLSIN.cPPT.PGK-GFP-PTS1.WPRE
(Plasmid #133282)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 133282 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRRLSIN.cPPT.PGK-GFP.WPRE
  • Backbone manufacturer
    Trono Lab
  • Backbone size w/o insert (bp) 7388
  • Total vector size (bp) 7530
  • Modifications to backbone
    Peroxisome targeting signal 1 addition at the C-terminal of the eGFP
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    eGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Peroxisome targeting signal 1
  • Alt name
    SKL (serine-lysine-leucine)
  • Alt name
    Peroxisomal localization for the eGFP
  • Insert Size (bp)
    142
  • Promoter None
  • Tag / Fusion Protein
    • Peroxisome targeting signal 1 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsrGI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GTGTTCCGCATTCTGCAAG
  • 3′ sequencing primer AGCAGCGTATCCACATAGCG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Original plasmids come from AddGene (pEGFP-C1+SKL (Plasmid #53450) & pRRLSIN.cPPT.PGK-GFP.WPRE (Plasmid #12252))

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

We are grateful to Trono lab members and Jay Brenman lab members for sharing the original plasmids used to make this plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRRLSIN.cPPT.PGK-GFP-PTS1.WPRE was a gift from Etienne Sokal (Addgene plasmid # 133282 ; http://n2t.net/addgene:133282 ; RRID:Addgene_133282)
  • For your References section:

    Accurate and live peroxisome biogenesis evaluation achieved by lentiviral expression of a green fluorescent protein fused to a peroxisome targeting signal 1. Demaret T, Courtoy GE, Ravau J, Van Der Smissen P, Najimi M, Sokal EM. Histochem Cell Biol. 2020 Mar 2. pii: 10.1007/s00418-020-01855-z. doi: 10.1007/s00418-020-01855-z. 10.1007/s00418-020-01855-z PubMed 32124009