-
PurposeCMV and T7 promoter plasmid for EGFP expression in mammalian cells or for in vitro transcription
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 133962 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV-T7
- Total vector size (bp) 4119
-
Modifications to backboneEGFP inserted into NotI/AgeI restriction sites
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)717
- Promoter CMV and T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer CMV forward - CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer BGH reverse - TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that this plasmid was not tested in bacterial expression models.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-T7-EGFP (BPK1098) was a gift from Benjamin Kleinstiver (Addgene plasmid # 133962 ; http://n2t.net/addgene:133962 ; RRID:Addgene_133962)