Skip to main content

pCMV-T7-EGFP (BPK1098)
(Plasmid #133962)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 133962 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCMV-T7
  • Total vector size (bp) 4119
  • Modifications to backbone
    EGFP inserted into NotI/AgeI restriction sites
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EGFP
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    717
  • Promoter CMV and T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer CMV forward - CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer BGH reverse - TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that this plasmid was not tested in bacterial expression models.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-T7-EGFP (BPK1098) was a gift from Benjamin Kleinstiver (Addgene plasmid # 133962 ; http://n2t.net/addgene:133962 ; RRID:Addgene_133962)