Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more


(Plasmid #134376)


This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134376 Standard format: Plasmid sent in bacteria as agar stab 1 $85


  • Vector backbone
  • Backbone size w/o insert (bp) 5400
  • Total vector size (bp) 6780
  • Vector type
    Mammalian Expression, Bacterial Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    ADRB2-Natural peptide of NanoLuciferase
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    ADRB2 (a.k.a. ADRB2R, ADRBR, ARB2, B2AR, BAR, BETA2AR)
  • Promoter T7
  • Tags / Fusion Proteins
    • signal sequence (N terminal on insert)
    • Flag (N terminal on insert)
    • natural peptide of nanoluciferase (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TTCCCAATCCTCCCCCTTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please Note: The plasmid contains a 72bp deletion in the backbone upstream of the SV40 promoter. This deletion is not known to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA.3.1.ADRB2-NP was a gift from Julien Hanson (Addgene plasmid # 134376 ; ; RRID:Addgene_134376)
  • For your References section:

    A dynamic and screening-compatible nanoluciferase-based complementation assay enables profiling of individual GPCR-G protein interactions. Laschet C, Dupuis N, Hanson J. J Biol Chem. 2019 Mar 15;294(11):4079-4090. doi: 10.1074/jbc.RA118.006231. Epub 2018 Dec 28. 10.1074/jbc.RA118.006231 PubMed 30593506