sg_shuttle_RFP657
(Plasmid
#134968)
-
Purpose(Empty Backbone) Lentiviral vector for sgRNA expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 134968 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepINDUCER21
- Backbone size (bp) 7458
-
Modifications to backboneThe lentiviral backbone is derived from pINDUCER21 (Addgene #75159) and modified to express sgRNA and RFP657.
-
Vector typeMammalian Expression, Lentiviral, CRISPR
- Promoter U6-sgRNA; EFS-RFP657
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsIn case of cloning multiple U6-sgRNA cassettes in one vector, grow the bacteria in 30°C.
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer gagggcctatttcccatgattc (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
sg_shuttle_RFP657 was a gift from Beat Bornhauser (Addgene plasmid # 134968 ; http://n2t.net/addgene:134968 ; RRID:Addgene_134968) -
For your References section:
Rapid Generation of Leukemogenic Chromosomal Translocations in Vivo Using CRISPR/Cas9. Huang Y, Marovca B, Dettwiler S, Bode PK, Bornhauser B, Bourquin JP. Hemasphere. 2020 Sep 30;4(5):e456. doi: 10.1097/HS9.0000000000000456. eCollection 2020 Oct. 10.1097/HS9.0000000000000456 PubMed 33134860