pAT1501-[PB-4xHSab-EF1a-Hygro_2A_rtTA3-SV40pA(-)_pCW-DEST]
(Plasmid
#134975)
-
Purpose(Empty Backbone) Destination vector for doxycycline-inducible expression from plasmid hosting piggyBac hygromycin cassettes
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 134975 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCR8/GW/TOPO
- Backbone size (bp) 11698
-
Vector typeMammalian Expression ; Gateway cloning
- Promoter TET
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)ccdB Survival
-
Growth instructionsAlso has kanamycin resistance.
-
Copy numberLow Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer taggcgtgtacggtgggagg
- 3′ sequencing primer tagaaggcacagtcgagg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAT1501-[PB-4xHSab-EF1a-Hygro_2A_rtTA3-SV40pA(-)_pCW-DEST] was a gift from Albert Cheng (Addgene plasmid # 134975 ; http://n2t.net/addgene:134975 ; RRID:Addgene_134975) -
For your References section:
Enhanced CRISPR-based DNA demethylation by Casilio-ME-mediated RNA-guided coupling of methylcytosine oxidation and DNA repair pathways. Taghbalout A, Du M, Jillette N, Rosikiewicz W, Rath A, Heinen CD, Li S, Cheng AW. Nat Commun. 2019 Sep 20;10(1):4296. doi: 10.1038/s41467-019-12339-7. 10.1038/s41467-019-12339-7 PubMed 31541098