p35S::mCh-HA-P2A-lifeact-mCh
(Plasmid
#135234)
-
Purposeconstitutive expression of 2 mCherry molecules: one tagged with HA and another that binds to actin (control plasmid)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 135234 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGGZ001
-
Backbone manufacturerAddgene plasmid # 48868
- Backbone size w/o insert (bp) 2687
- Total vector size (bp) 8383
-
Modifications to backboneN/A
-
Vector typePlant Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCh-HA-P2A-lifeact-mCh
-
Insert Size (bp)1621
- Promoter 35S
-
Tags
/ Fusion Proteins
- HA (C terminal on insert)
- p2a (C terminal on insert)
- lifeact (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer TCAAAGCAAGTGGATTGATG
- 3′ sequencing primer GAAAGAGATAACAGGAACGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/825190v1?rss=1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p35S::mCh-HA-P2A-lifeact-mCh was a gift from Armin Djamei (Addgene plasmid # 135234 ; http://n2t.net/addgene:135234 ; RRID:Addgene_135234) -
For your References section:
A high-throughput screening method to identify proteins involved in unfolded protein response of the endoplasmic reticulum in plants. Alcantara A, Seitner D, Navarrete F, Djamei A. Plant Methods. 2020 Jan 21;16:4. doi: 10.1186/s13007-020-0552-3. eCollection 2020. 10.1186/s13007-020-0552-3 PubMed 31988651