Skip to main content

pHAGE-mt-mKeima-P2A-FRB-Fis1
(Plasmid #135295)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 135295 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHAGE
  • Backbone size w/o insert (bp) 6436
  • Total vector size (bp) 7783
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mt-mKeima-P2A-FRB-Fis1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1341
  • Mutation
    mt-mKeima is fused with FRB-Fis1 via P2A seqeunce
  • GenBank ID
    NM_016068.3
  • Entrez Gene
    FIS1 (a.k.a. CGI-135, TTC11)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer ATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHAGE-mt-mKeima-P2A-FRB-Fis1 was a gift from Richard Youle (Addgene plasmid # 135295 ; http://n2t.net/addgene:135295 ; RRID:Addgene_135295)
  • For your References section:

    Spatiotemporal Control of ULK1 Activation by NDP52 and TBK1 during Selective Autophagy. Vargas JNS, Wang C, Bunker E, Hao L, Maric D, Schiavo G, Randow F, Youle RJ. Mol Cell. 2019 Apr 18;74(2):347-362.e6. doi: 10.1016/j.molcel.2019.02.010. Epub 2019 Mar 7. 10.1016/j.molcel.2019.02.010 PubMed 30853401