Skip to main content

pHAGE2-TetOminiCMV-OSKM
(Plasmid #136541)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 136541 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHAGE2
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 11320
  • Vector type
    Bacterial Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Oct4-P2A-Sox2-T2A-Klf4-E2A-cMyc
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    5000
  • Entrez Gene
    Sox2 (a.k.a. Sox-2, lcc, ysb)
  • Entrez Gene
    Pou5f1 (a.k.a. NF-A3, Oct-3, Oct-3/4, Oct-4, Oct3, Oct3/4, Oct4, Otf-3, Otf-4, Otf3, Otf3-rs7, Otf3g, Otf4)
  • Entrez Gene
    Myc (a.k.a. Myc2, Niard, Nird, bHLHe39)
  • Entrez Gene
    Klf4 (a.k.a. EZF, Gklf, Zie)
  • Promoter tetO-miniCMV (dox-inducible)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site ClaI (unknown if destroyed)
  • 5′ sequencing primer GAGACGCCATCCACGCTGT
  • 3′ sequencing primer AGGAAGGTCCGCTGGATTGA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    doi.org/10.1073/pnas.0811426106
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHAGE2-TetOminiCMV-OSKM was a gift from Hans Schöler (Addgene plasmid # 136541 ; http://n2t.net/addgene:136541 ; RRID:Addgene_136541)
  • For your References section:

    Excluding Oct4 from Yamanaka Cocktail Unleashes the Developmental Potential of iPSCs. Velychko S, Adachi K, Kim KP, Hou Y, MacCarthy CM, Wu G, Scholer HR. Cell Stem Cell. 2019 Oct 30. pii: S1934-5909(19)30423-0. doi: 10.1016/j.stem.2019.10.002. 10.1016/j.stem.2019.10.002 PubMed 31708402