Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pHAGE2-TetOminiCMV-SKM
(Plasmid #136551)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 136551 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pHAGE2
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 10186
  • Vector type
    Bacterial Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Sox2-T2A-Klf4-E2A-cMyc
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    4000
  • Entrez Gene
    Sox2 (a.k.a. Sox-2, lcc, ysb)
  • Entrez Gene
    Klf4 (a.k.a. EZF, Gklf, Zie)
  • Entrez Gene
    Myc (a.k.a. Myc2, Niard, Nird, bHLHe39)
  • Promoter tetO-miniCMV (dox-inducible)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer GAGACGCCATCCACGCTGT
  • 3′ sequencing primer AGGAAGGTCCGCTGGATTGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHAGE2-TetOminiCMV-SKM was a gift from Hans Schöler (Addgene plasmid # 136551 ; http://n2t.net/addgene:136551 ; RRID:Addgene_136551)
  • For your References section:

    Excluding Oct4 from Yamanaka Cocktail Unleashes the Developmental Potential of iPSCs. Velychko S, Adachi K, Kim KP, Hou Y, MacCarthy CM, Wu G, Scholer HR. Cell Stem Cell. 2019 Oct 30. pii: S1934-5909(19)30423-0. doi: 10.1016/j.stem.2019.10.002. 10.1016/j.stem.2019.10.002 PubMed 31708402