Skip to main content

pAAV-CaMKII-nirButterfly
(Plasmid #136591)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 136591 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV-CW3SL
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    nirButterfly
  • Species
    Synthetic
  • Promoter CaMKIIa

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GGTTCTCCGTTTGCACTCAG
  • 3′ sequencing primer TGAAAGCCATACGGGAAGCAATAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/536359v1 for BioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CaMKII-nirButterfly was a gift from Vladislav Verkhusha (Addgene plasmid # 136591 ; http://n2t.net/addgene:136591 ; RRID:Addgene_136591)
  • For your References section:

    Screening and Cellular Characterization of Genetically Encoded Voltage Indicators Based on Near-Infrared Fluorescent Proteins. Monakhov MV, Matlashov ME, Colavita M, Song C, Shcherbakova DM, Antic SD, Verkhusha VV, Knopfel T. ACS Chem Neurosci. 2020 Nov 4;11(21):3523-3531. doi: 10.1021/acschemneuro.0c00046. Epub 2020 Oct 16. 10.1021/acschemneuro.0c00046 PubMed 33063984