pCAG-HASAP
(Plasmid
#138325)
-
Purposechemigenetic voltage indicator
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 138325 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAG
- Total vector size (bp) 7617
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHASAP
-
Insert Size (bp)1512
- Promoter CAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggaattcactcctcaggtgc
- 3′ sequencing primer gactcgagcggccgcc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.01.08.898783v1 for BioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-HASAP was a gift from Eric Schreiter (Addgene plasmid # 138325 ; http://n2t.net/addgene:138325 ; RRID:Addgene_138325) -
For your References section:
The HaloTag as a general scaffold for far-red tunable chemigenetic indicators. Deo C, Abdelfattah AS, Bhargava HK, Berro AJ, Falco N, Farrants H, Moeyaert B, Chupanova M, Lavis LD, Schreiter ER. Nat Chem Biol. 2021 Jun;17(6):718-723. doi: 10.1038/s41589-021-00775-w. Epub 2021 Apr 1. 10.1038/s41589-021-00775-w PubMed 33795886