Skip to main content

pACDura3
(Plasmid #138711)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 138711 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pACD4K-C
  • Backbone manufacturer
    Sigma-Aldrich
  • Backbone size w/o insert (bp) 7675
  • Total vector size (bp) 7264
  • Modifications to backbone
    First, retro-transposition-activated selectable marker (RAM) in pACD4K-C was excised by digestion with mluI enzyme. Then, optimized ura3 gene was amplified by PCR, digested with mluI and ligated with mluI-digested pACD4K-C vector.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    ura3 gene
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    963
  • Mutation
    optimized ura3 gene for expression in Escherichia coli
  • Entrez Gene
    URA3 (a.k.a. YEL021W)
  • Promoter pEM7 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site mluI (not destroyed)
  • 3′ cloning site mluI (not destroyed)
  • 5′ sequencing primer ATGTCCAAGGCTACTTACAAGG
  • 3′ sequencing primer ATGATAATATCAGAGCCGGTAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pACDura3 was a gift from Víctor de Lorenzo (Addgene plasmid # 138711 ; http://n2t.net/addgene:138711 ; RRID:Addgene_138711)
  • For your References section:

    Recombination-Independent Genome Editing through CRISPR/Cas9-Enhanced TargeTron Delivery. Velazquez E, Lorenzo V, Al-Ramahi Y. ACS Synth Biol. 2019 Sep 20;8(9):2186-2193. doi: 10.1021/acssynbio.9b00293. Epub 2019 Sep 3. 10.1021/acssynbio.9b00293 PubMed 31419111