Skip to main content

pmCherry-2xFYVE
(Plasmid #140050)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140050 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pmCherry-C3
  • Backbone manufacturer
    Clontech / in-house cloning
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 5210
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    tandem HRS FYVE domain
  • Alt name
    HGS
  • Species
    M. musculus (mouse)
  • Mutation
    two FYVE domains (amino acids 147-223), linked by QGQGS linker
  • GenBank ID
    15239
  • Entrez Gene
    Hgs (a.k.a. Hgr, Hrs, ZFYVE8, tn)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI in backbone/MfeI in insert (destroyed during cloning)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer CCCCGTAATGCAGAAGAAGA
  • 3′ sequencing primer GTGGTTTGTCCAAACTCATC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmCherry-2xFYVE was a gift from Harald Stenmark (Addgene plasmid # 140050 ; http://n2t.net/addgene:140050 ; RRID:Addgene_140050)
  • For your References section:

    WDFY2 restrains matrix metalloproteinase secretion and cell invasion by controlling VAMP3-dependent recycling. Sneeggen M, Pedersen NM, Campsteijn C, Haugsten EM, Stenmark H, Schink KO. Nat Commun. 2019 Jun 28;10(1):2850. doi: 10.1038/s41467-019-10794-w. 10.1038/s41467-019-10794-w PubMed 31253801