Skip to main content

pCMV-GenEPi
(Plasmid #140236)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140236 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCMV
  • Backbone size w/o insert (bp) 3975
  • Total vector size (bp) 12912
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GenEPi (Piezo1-based fluorescent force sensor)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    7568
  • Entrez Gene
    PIEZO1 (a.k.a. DHS, ER, FAM38A, LMPH3, LMPHM6, Mib)
  • Promoter simian CMV IE94
  • Tag / Fusion Protein
    • GCaMP 6s RS1 EF4 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer gaggtctatataagcagagctgg
  • 3′ sequencing primer GGCAAGCTGACCCTGAAGTT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/702423 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-GenEPi was a gift from Periklis Pantazis (Addgene plasmid # 140236 ; http://n2t.net/addgene:140236 ; RRID:Addgene_140236)
  • For your References section:

    Highly specific and non-invasive imaging of Piezo1-dependent activity across scales using GenEPi. Yaganoglu S, Kalyviotis K, Vagena-Pantoula C, Julich D, Gaub BM, Welling M, Lopes T, Lachowski D, Tang SS, Hernandez ADR, Salem V, Muller DJ, Holley SA, Vermot J, Shi J, Helassa N, Torok K, Pantazis P. Nat Commun. 2023 Jul 19;14(1):4352. doi: 10.1038/s41467-023-40134-y. 10.1038/s41467-023-40134-y PubMed 37468521