-
Purpose3rd Generation lentiviral vector expressing the codon-optimized SARS-CoV2 Spike Glycoprotein ORF with a C-terminal HA tag generated by Junko Ogawa & Gerald M Pao
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 141347 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBOB-CAG
-
Backbone manufacturerVerma Lab (Salk Institute)
- Total vector size (bp) 13475
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsdo not overgrow
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSARS-CoV2 Spike Glycoprotein
-
Alt nameSpike
-
Alt nameS
-
SpeciesSARS-CoV2 hCoV19_USA EPI_ISL_414366 (GISAID)
-
Insert Size (bp)3858
-
Mutationresynthesized with human codon optimization nucleotide sequence does not match original sequence.
-
Entrez GeneS (a.k.a. GU280_gp02, spike glycoprotein)
- Promoter CAG
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAG-FWD AGCCTCTGCTAACCATGTTC
- 3′ sequencing primer WPRE-REV TCCTCCTCCTCTTGTGCTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBOB-CAG-SARS-CoV2-Spike-HA was a gift from Gerald Pao (Addgene plasmid # 141347 ; http://n2t.net/addgene:141347 ; RRID:Addgene_141347) -
For your References section:
The D614G mutation in the SARS-CoV2 Spike protein increases infectivity in an ACE2 receptor dependent manner. Ogawa J, Zhu W, Tonnu N, Singer O, Hunter T, Ryan AL, Pao GM. bioRxiv. 2020 Jul 22. doi: 10.1101/2020.07.21.214932. 10.1101/2020.07.21.214932 PubMed 32743569